WorldCat Identities

Thomas, Donald S.

Overview
Works: 5 works in 7 publications in 1 language and 475 library holdings
Roles: Author
Publication Timeline
.
Most widely held works by Donald S Thomas
Fathometer data from Bart Lake and Lake Dorothy near Juneau, Alaska, 1988-89 by Harold R Seitz( Book )

2 editions published between 1990 and 1991 in English and held by 121 WorldCat member libraries worldwide

The storage and release of water from a large glacier-dammed lake : Russell Lake near Yakutat, Alaska, 1986 by Harold R Seitz( Book )

2 editions published in 1986 in English and held by 114 WorldCat member libraries worldwide

This report is a summary of the events at Russell Fiord/Lake near Yakutat, Alaska during the summer of 1986 and includes tabulated data and graphs of the measured and recorded water levels in the lake
AFGWC forward trajectory model. /by Capt. Donald S. Thomas Jr by Donald S Thomas( Book )

1 edition published in 1971 in English and held by 2 WorldCat member libraries worldwide

Molecular modelling and NMR studies of multinuclear platinum anticancer complexes by Donald S Thomas( Book )

1 edition published in 2006 in English and held by 1 WorldCat member library worldwide

[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{ & mu;-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t, t, t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t, t, t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H, & sup15;N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(& mu;- NH2(CH2)6NH2)]2+ (1,1/t, t) and [{cis-PtCl(NH3)2}2(& mu;-NH2(CH2)6NH2)]2+ (1,1/c, c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis ... The work described in Chapter 6 employed three duplexes; 5o-d(TCTCCTATTCGCTTATCTCTC)-3o·5o- d(GAGAGATAAGCGAATAGGAGA)-3o (VB12), 5o-d(TCTCCTTCTTGTTCTTCCTCC)- 3o·5o-d(GGATTAAGAACAAGAAGGAGA)-3o (VB14) and 5o- d(CTCTCTCTATTGTTATCTCTTCT)-3o·5o-d(AGAAGAGATAACTATAGAGAGAG)-3o (VB16). Two minor groove preassociated forms of 1,0,1/t, t, t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3o & rarr;3o and 5o & rarr;5o directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t, t, t. Here it was found that the monofunctionally anchored 1,0,1/t, t, t adopted a position along the phosphate backbone of the duplex in the 5o & rarr;5o direction
Hubbard Glacier, Alaska : growing and advancing in spite of global climate change and the 1986 and 2002 Russell Lake outburst floods by Dennis Trabant( )

1 edition published in 2003 in English and held by 0 WorldCat member libraries worldwide

 
Audience Level
0
Audience Level
1
  Kids General Special  
Audience level: 0.57 (from 0.42 for Molecular ... to 0.88 for AFGWC forw ...)

Languages